View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1595_low_12 (Length: 256)
Name: NF1595_low_12
Description: NF1595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1595_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 66 - 209
Target Start/End: Complemental strand, 35354525 - 35354378
Alignment:
| Q |
66 |
aatatttgatcatccctgcaaatgccacacagtcaaaatcttaacatagattaatgtttaatagaaagagtattatttaaaggg----nnnnnnnnnnnn |
161 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35354525 |
aatatttgatcatccctgcaaatgccaaacagtcaaaatcttaacatagattaatgtttaatagaaaaagtattatttaaagggaaaataaaaaaaaaaa |
35354426 |
T |
 |
| Q |
162 |
nnnttggaactaaccaattggtttctctatcaacttgttcgaattcaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354425 |
aaattggaactaaccaattggtttctctatcaacttgttcgaattcaa |
35354378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 35369456 - 35369412
Alignment:
| Q |
165 |
ttggaactaaccaattggtttctctatcaacttgttcgaattcaa |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
35369456 |
ttggaattaaccaattggtttctctatcgacttgttcaaattcaa |
35369412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 66 - 109
Target Start/End: Complemental strand, 19684091 - 19684048
Alignment:
| Q |
66 |
aatatttgatcatccctgcaaatgccacacagtcaaaatcttaa |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
19684091 |
aatatttgatcatccctgcaaatgtcacacaatgaaaatcttaa |
19684048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University