View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1595_low_12 (Length: 256)

Name: NF1595_low_12
Description: NF1595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1595_low_12
NF1595_low_12
[»] chr7 (2 HSPs)
chr7 (66-209)||(35354378-35354525)
chr7 (165-209)||(35369412-35369456)
[»] chr4 (1 HSPs)
chr4 (66-109)||(19684048-19684091)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 66 - 209
Target Start/End: Complemental strand, 35354525 - 35354378
Alignment:
66 aatatttgatcatccctgcaaatgccacacagtcaaaatcttaacatagattaatgtttaatagaaagagtattatttaaaggg----nnnnnnnnnnnn 161  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||                    
35354525 aatatttgatcatccctgcaaatgccaaacagtcaaaatcttaacatagattaatgtttaatagaaaaagtattatttaaagggaaaataaaaaaaaaaa 35354426  T
162 nnnttggaactaaccaattggtttctctatcaacttgttcgaattcaa 209  Q
       |||||||||||||||||||||||||||||||||||||||||||||    
35354425 aaattggaactaaccaattggtttctctatcaacttgttcgaattcaa 35354378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 35369456 - 35369412
Alignment:
165 ttggaactaaccaattggtttctctatcaacttgttcgaattcaa 209  Q
    |||||| ||||||||||||||||||||| |||||||| |||||||    
35369456 ttggaattaaccaattggtttctctatcgacttgttcaaattcaa 35369412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 66 - 109
Target Start/End: Complemental strand, 19684091 - 19684048
Alignment:
66 aatatttgatcatccctgcaaatgccacacagtcaaaatcttaa 109  Q
    |||||||||||||||||||||||| |||||| | ||||||||||    
19684091 aatatttgatcatccctgcaaatgtcacacaatgaaaatcttaa 19684048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University