View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1595_low_3 (Length: 325)
Name: NF1595_low_3
Description: NF1595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1595_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 22 - 156
Target Start/End: Original strand, 24240359 - 24240493
Alignment:
| Q |
22 |
atagataagatatagaggagcaattagcagagctaggggccactgtacacacttgcgctaggaacgaagttgaactcaatgaatgcttaaatcaatgggt |
121 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24240359 |
atagatatgatatagtggagcaattagcagagctaggggccactgtacacacttgtgctaggaacgaagctgaactcaatgaatgcttaaatcaatgggt |
24240458 |
T |
 |
| Q |
122 |
cacaaaaggatacaaaataacaggttcagtctgtg |
156 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |
|
|
| T |
24240459 |
cacaaaaggatacaaaatcactggttcagtctgtg |
24240493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University