View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1595_low_8 (Length: 289)
Name: NF1595_low_8
Description: NF1595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1595_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 3983719 - 3983995
Alignment:
| Q |
1 |
ctgctgtgcatgatgtctgtctatgaaatacatttcatttggagttcttttatatgcaggtagtgttggcccgtggttgttttgatgacacaaaggtttt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983719 |
ctgctgtgcatgatgtctgt--atgaaatacatttcatttggagttcttttatatgcaggtagtgttggcccgtggttgttttgatgacacaaaggtttt |
3983816 |
T |
|
| Q |
101 |
agcacatactttttatctttcatttcaattgatttcaaggtttaggattctatagcaaattttttcctcagaaatgcactaaattttgtgcttcagggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983817 |
agcacatactttttatctttcatttcaattgatttcaaggtttaggattctatagcaaattttttcctcagaaatgcactaaattttgtgcttcagggag |
3983916 |
T |
|
| Q |
201 |
ctatcttaataaaaaacctagcagccaaggatccttcagcacttggtttggacacttattacaagcagtattatctgtg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983917 |
ctatcttaataaaaaacctagcagccaaggatccttcagcacttggtttggacacttattacaagcagtattatctgtg |
3983995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University