View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_high_4 (Length: 622)
Name: NF15960_high_4
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 113 - 481
Target Start/End: Original strand, 28896449 - 28896817
Alignment:
| Q |
113 |
ctgaagtatatggaaggcaagacatgaaagctcttttagagtaagtaaaattgtgtagataagatagttgaggaggcgaacttgtcctcttggaattggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896449 |
ctgaagtatatggaaggcaagacatgaaagctcttttagagtaagtaaaattgtgtagataagatagttgaggaggcgaacttgtcctcttggaattggt |
28896548 |
T |
 |
| Q |
213 |
tgagtattaaatcgaataaccttgattataacatatcacaatggtgcctgaatccaatggcttgccttagtctctcgcgacaagatttgccttgtgttga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28896549 |
tgagtattaaatcgaataaccttgattataacatatcacaatggtgcctgaatccaatggcttgccttagtctgtcgcgacaagatttgccttgtgttga |
28896648 |
T |
 |
| Q |
313 |
tcttaaaatcaaggctagcgctgcaacttttggcgttgcaggtaggcagggttctatagtggggcaggacggatcttaagctagaaataggtagcagatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| | ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28896649 |
tcttaaaatcaaggctagcgctgcaagttttggcgttgcaggtgggcagggttctatggaggggcgggacggatcttaagctagaaataggtagcagatt |
28896748 |
T |
 |
| Q |
413 |
ttgtagttcttgtcttggtgaacctgtgagtaaagcctgatgctattggacaacagttgcatctttaag |
481 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28896749 |
ttgtagttcttgtcttggtgaacctgggagtaaagcctgatgctattggacaagagttgcatctttaag |
28896817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University