View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_high_47 (Length: 295)
Name: NF15960_high_47
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 279
Target Start/End: Complemental strand, 33408778 - 33408507
Alignment:
| Q |
10 |
agatgaaggtatccggtctagcaatattgacgttgctaattaagctaaacttacggacatataacattaactaaaccacctttcaagaagaannnnnnnn |
109 |
Q |
| |
|
||||||||||||| | ||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33408778 |
agatgaaggtatctgatctagcaatattggcgttgttaattgagctaaacttacggacatataacattaactaaaccacctttcaagaagaagaaaaaat |
33408679 |
T |
 |
| Q |
110 |
nagctaaaccaatcataatatatccaaacgatttgggcaacatggtctacacatagcatccatttgcagtcaaaatgacttaactgttgtccgagagagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33408678 |
tagctaaaccaatcataatatatccaaacgatttgggcaacatggtctacacagagcatccatttgcagtcaaaatgacttaactgttgtccgagagagg |
33408579 |
T |
 |
| Q |
210 |
caattttct-ctcattcttgagagcttcttcttcca-cctcccattcttaaaaactgcatcctctaaatttg |
279 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||| |
|
|
| T |
33408578 |
caattttctcctcattcttgagagcttcttcttccacccccccattcttaaaaactgcatcccctaaatttg |
33408507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University