View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_high_62 (Length: 239)
Name: NF15960_high_62
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_high_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 44569662 - 44569861
Alignment:
| Q |
11 |
cacagagtgacaaaacttgcaaacttataagtttgccaattgactggggaggtattttgattttgcggtaatatgagaggttggcaacacgcaggtgttc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
44569662 |
cacaaagtgacaaaacttgcaaacttatgagtttgccaattgactggggaggtattttgattttgcggttatatgagaggttggcaacacgaaggtgttc |
44569761 |
T |
 |
| Q |
111 |
taatttagcaattgaattaggcaaagtcattaatgaagaatcacttaaatctaaagattgtaagtatttgttttttgatccatttctccaacaaaatttc |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| | | ||| | ||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
44569762 |
taatttagcaattgaattaggcagagtcattaatg--gcaacac---------acaattgtaagtatttattttttgatccagttctccaacaaaatttc |
44569850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 165
Target Start/End: Original strand, 35951486 - 35951552
Alignment:
| Q |
99 |
acgcaggtgttctaatttagcaattgaattaggcaaagtcattaatgaagaatcacttaaatctaaa |
165 |
Q |
| |
|
||||||||| |||||||| | ||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
35951486 |
acgcaggtgctctaattttgtaattgaattgggcagagtttcaaatgaagaatcacttaaatctaaa |
35951552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University