View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_high_65 (Length: 237)
Name: NF15960_high_65
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_high_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 2097043 - 2097249
Alignment:
| Q |
13 |
agcagagaaaccccccacagaacccccaacatcagagagaaccaatgatacagccaaaccaagacccctggagaaattaaatcatttcattgcagaaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097043 |
agcagagaaaccccccacagaacccccaacatcagagagaaccaatgatacagccaaaccaagacccctggagaaattaaatcatttcattgcagaaatt |
2097142 |
T |
 |
| Q |
113 |
ccaaatggtccacacaacaacgtgccaaact-aaagccagaccaaaccttggtttttcttagacctaaaactcgtnnnnnnnncctcaaaaactccttca |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2097143 |
ccaaatggttcacacaacaacgtgccaaactaaaagccagaccaaactttggtttttcttagacctaagactcgtaaaaaaaa-ctcaaaaactccttca |
2097241 |
T |
 |
| Q |
212 |
gataaaga |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
2097242 |
gataaaga |
2097249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University