View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_high_70 (Length: 210)
Name: NF15960_high_70
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_high_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 23995425 - 23995605
Alignment:
| Q |
16 |
atgaagaacaaatacccttcttctggagtcatcaaatattgtgctgaatcttacagtggtgcagttaatgagttaaaggatgcgtttagtgaggaggatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23995425 |
atgaagaacaaatacccttcttctggagtcatcaaatattgtgctgaatcttacagtggtgcagttaatgagttaaaggatgcgtttagtgaggaggatc |
23995524 |
T |
 |
| Q |
116 |
cagatctcctaatcatgtctgtgcaatatgcttactatgcaattggcgcgtgtgaacatgtcttagctcaggaaaagagtg |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23995525 |
cagatctcataatcatgtctgtgcaatatgcttactatgcaattggcgcgtgtgaacatgtcttagctcaggaaaagagtg |
23995605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University