View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_high_72 (Length: 203)
Name: NF15960_high_72
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_high_72 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 44289393 - 44289581
Alignment:
| Q |
1 |
ccccccacgcattgaatgcacattgtttctgcattattatctctttttctcattggagaaaatctctttcttgtctagtctcttcccaaacctatgatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44289393 |
ccccccacgcattgaatgcacattgtttctgcattattatctctttttctcattggagaaaatctctttcttgtctagtctcttcccaaacctatgatca |
44289492 |
T |
|
| Q |
101 |
attcagca-tctcttccttccacctgtcaacatctaaatctatctttcccaaactcttcttgtcttttttcccattactgttctctctg |
188 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44289493 |
attcagcattctcttccttccacctgtcaacatctaaatctatctttcccaaactcttcttgtcttttttcccattactgttctctctg |
44289581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University