View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_12 (Length: 514)
Name: NF15960_low_12
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 6e-60; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 112 - 305
Target Start/End: Complemental strand, 29816707 - 29816514
Alignment:
| Q |
112 |
aattgggatatgagttgtgtgctctcacaatcccgtagccacatatatgtcgttggattaaaattggacggttcatatgcggctgagtacgtgcgatcac |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||| || |||||||| |||||||| |||||| | ||||| |||| |
|
|
| T |
29816707 |
aattgggatatgagttgtgtgctgtcacaatcccgtagccacgtctatgtcgttggatcaagattggacgattcatatggggctgactgcgtgcagtcac |
29816608 |
T |
|
| Q |
212 |
actgtacacggttgagatgcaaacaattttccatgatttcaaaatctattgagtcaaaataaattaatgctagcaccccaataaaggaaaaaag |
305 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
29816607 |
actgtacacggttgaaatcccaacaattttccatgatttcaaaatcactagagtcaaaataaattaatcctagcaccccaagaaaggaaaaaag |
29816514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 29818213 - 29818172
Alignment:
| Q |
1 |
tcctccacaaaaggcttctctggctctgatgttgctggttga |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29818213 |
tcctccacaaaaggcttctctggctctgatgttgctggttga |
29818172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 453 - 498
Target Start/End: Complemental strand, 29815548 - 29815503
Alignment:
| Q |
453 |
aaagtgggattagaagcatgcatttttgtaaattataaggactaac |
498 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29815548 |
aaagtggaattagaagcatgcatttttgtaaattatatggactaac |
29815503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 301 - 341
Target Start/End: Complemental strand, 29815928 - 29815888
Alignment:
| Q |
301 |
aaaagtattggtaaaataggtgttgaagtgaaagtgtatca |
341 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
29815928 |
aaaagtattggtaaaataggagttgaagggaaagtgtatca |
29815888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University