View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_15 (Length: 472)
Name: NF15960_low_15
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 113 - 453
Target Start/End: Original strand, 14854439 - 14854779
Alignment:
| Q |
113 |
ggtaaactcgtcaccactctcttccaaaccaccggccgcgccaccaacaacttcggctccgttaatatcacccactccccgaacactaacactgttacaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14854439 |
ggtaaactcgtcaccactctcttccaaaccaccggccgcgccaccaacaacttcggctccgttaatatcacccactccccgaacactaacactgttacaa |
14854538 |
T |
|
| Q |
213 |
tccattccccagcaccttactcatcctcaaacgccaccgtgctttcacagctcaaaatgttaccctacaatctcactatcttcaccgttgattctctctt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14854539 |
tccattccccagcaccttactcatcctcaaacgccaccgtgctttcacagctcaaaatgttaccctacaatctcactatcttcaccgttgattctctctt |
14854638 |
T |
|
| Q |
313 |
aatcccttatggtttcgatctcatggcatcggaaactcgtcctagcattcttctcaacatcaccaaaaccctaatcgacgctcacaattttaacgtcgct |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14854639 |
aatcccttatggtttcgatctcatggcatcggaaactcgtcctagcattcttctcaacatcaccaaaaccctaatcgacgctcacaatttcaacgtcgct |
14854738 |
T |
|
| Q |
413 |
gcttcaatgctctctgcttccggcgtcgtgaacgaattcga |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14854739 |
gcttcaatgctctctgcttccggcgtcgtgaacgaattcga |
14854779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University