View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_23 (Length: 414)
Name: NF15960_low_23
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 201 - 394
Target Start/End: Original strand, 28586099 - 28586292
Alignment:
| Q |
201 |
gtgggatattatgacctttgttacaatcctatgatctacgctttttctatatcctcaatttttagcgggatttcgattttggcaaccatactcttgagta |
300 |
Q |
| |
|
||||||||||| || |||| |||| |||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
28586099 |
gtgggatattacgatctttattacgatcctatgatctacgctttttctataccatcaatttttagtgggatttcgattttggcaaccatactctagagta |
28586198 |
T |
 |
| Q |
301 |
atatttgaatgcatcatagtctagtgcaatattttaaatgcccaaggagaatgactaaactaagtcggataaatgaggacttctggaagtgaca |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28586199 |
atatttgaatgcatcatagtctagtgcaatattttaaatgcccatggagaatgactaaactaagtcggataaatgaggacttctggacgtgaca |
28586292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 103 - 145
Target Start/End: Original strand, 28585997 - 28586039
Alignment:
| Q |
103 |
cttagatgatgcttaagacaataaaaattatgattaatgaaag |
145 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28585997 |
cttagatgatgcttaagacaatgaaaattatgattaatgaaag |
28586039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 28585891 - 28585928
Alignment:
| Q |
1 |
tgaaagatgtcgggcttgatcataatgtcttgttgaac |
38 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28585891 |
tgaaagatgtcgggcttgatcataatgttttgttgaac |
28585928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 192 - 250
Target Start/End: Complemental strand, 6739444 - 6739386
Alignment:
| Q |
192 |
gtctattaggtgggatattatgacctttgttacaatcctatgatctacgctttttctat |
250 |
Q |
| |
|
||||||||||||||| ||| || | ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
6739444 |
gtctattaggtgggagcttacgatccttgttacgatcctatgatctacgctctttctat |
6739386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 192 - 289
Target Start/End: Complemental strand, 41708650 - 41708551
Alignment:
| Q |
192 |
gtctattaggtgggatattatgacctttgttacaatcctatgatctacgctttttctatatcc--tcaatttttagcgggatttcgattttggcaaccat |
289 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||| |||||| |||||||||| |||||||| || | || ||||| ||||| ||||||||| ||||||| |
|
|
| T |
41708650 |
gtctattaggtgggatcttatgatccttgttacgatcctacgatctacgctctttctataccccaacgatctttagtgggatctcgattttgacaaccat |
41708551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 192 - 289
Target Start/End: Original strand, 36653120 - 36653218
Alignment:
| Q |
192 |
gtctattaggtgggatattatgacctttgttacaatcctatgatctacgctttttctatatcctca--atttttagcgggatttcgattttggcaaccat |
289 |
Q |
| |
|
|||||||| |||||| ||| || | ||||||| |||||| ||||||||||||||||||| ||||| || ||||| ||||| |||||||| ||||||| |
|
|
| T |
36653120 |
gtctattatatgggatcttacgatccttgttacgatcctacgatctacgctttttctata-cctcacgatctttagtgggatcccgattttgacaaccat |
36653218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 44266624 - 44266565
Alignment:
| Q |
192 |
gtctattaggtgggatattatgacctttgttacaatcctatgatctacgctttttctata |
251 |
Q |
| |
|
|||||||||||||||| ||| || | ||||||| |||||| |||||||||| |||||||| |
|
|
| T |
44266624 |
gtctattaggtgggatcttacgatccttgttacgatcctacgatctacgctctttctata |
44266565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 193 - 247
Target Start/End: Original strand, 49835074 - 49835128
Alignment:
| Q |
193 |
tctattaggtgggatattatgacctttgttacaatcctatgatctacgctttttc |
247 |
Q |
| |
|
|||||| |||||||| ||| || ||||||||| |||||| ||||||||||||||| |
|
|
| T |
49835074 |
tctatttggtgggatcttacgatctttgttacgatcctacgatctacgctttttc |
49835128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University