View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_41 (Length: 324)
Name: NF15960_low_41
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 31 - 306
Target Start/End: Original strand, 25587467 - 25587742
Alignment:
| Q |
31 |
tggtgtattcttcacttccacttccagtactctcattccctttcattcccaaaaggaggccaaaatgcttttctgtaagcccttcacttttttcatttac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25587467 |
tggtgtattcttcacttccacttccagtactctcattccctttcattcccaaaaggaggccaaaatgcttttctgtaagcccttcacttttttcatttac |
25587566 |
T |
|
| Q |
131 |
ttattttcctatcacattgcttcttaattttcgaagcaataaaatggtgtatgcttcactttcactatcacttctcatcttcattttcctttgcaaacca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25587567 |
ttattttcctatcacattgcttcttaattttggaagcaataaaatggtgtatgcttcactttcactatcacttctcatcttcattttcctttgcaaacca |
25587666 |
T |
|
| Q |
231 |
ttcctctcagctggtcccccttcacttcctatttaatttttatgcattttctaaataaaaatttccattgtttcct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25587667 |
ttcctctcagctggtcccccttcacttcctatttaatttttatgcattttctaaataaaaatttccattgtttcct |
25587742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University