View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_49 (Length: 294)
Name: NF15960_low_49
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 6 - 277
Target Start/End: Complemental strand, 34915701 - 34915429
Alignment:
| Q |
6 |
aggagcacagactcccgctccggtttttggaaatactggtattgggcagtcgggatttggagaactacttgaaaaacttgaggccataacagccaggtta |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34915701 |
aggatcacagactcccgctccggtttttggaaatactggtattgggcagtcgggatttggagaactacttgaaaaacttgaggccataacagccaggtta |
34915602 |
T |
|
| Q |
106 |
cagacattgtttagtcaaccttgagtagctagttactca-ctacaactgaactgatgtagatagatagatagatatatttccttttaaatttttgcttat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34915601 |
cagacattgtttagtcaaccttgagtagctagttactcagctacaactgaactgatgtagatagatagatagatatatttccttttaaatttttgcttat |
34915502 |
T |
|
| Q |
205 |
ttcaagtgacagtggggatggaaagcttcaaagtgtctatttgcctgcctgtgaaattttgaaaggcaaagct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34915501 |
ttcaagtgacagtggggatggaaagcttcaaagtgtctatttgcctgcctgtgaaattctgaaaggcaaagct |
34915429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 34909469 - 34909418
Alignment:
| Q |
16 |
actcccgctccggtttttggaaatactggtattgggcagtcgggatttggag |
67 |
Q |
| |
|
||||| ||||||| |||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
34909469 |
actcctgctccgggttttggaaatgctgatattgggcagtcgggatttggag |
34909418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 67
Target Start/End: Complemental strand, 34906075 - 34906014
Alignment:
| Q |
6 |
aggagcacagactcccgctccggtttttggaaatactggtattgggcagtcgggatttggag |
67 |
Q |
| |
|
|||| ||||||||||| ||| | ||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
34906075 |
aggatcacagactcccactcaagcatttggaagtactggtattgggcagtcaggatttggag |
34906014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 67
Target Start/End: Complemental strand, 34895541 - 34895505
Alignment:
| Q |
31 |
tttggaaatactggtattgggcagtcgggatttggag |
67 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
34895541 |
tttggaagtactggtattgggcagtcaggatttggag |
34895505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University