View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_56 (Length: 266)
Name: NF15960_low_56
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 45311937 - 45311699
Alignment:
| Q |
18 |
ctatcttagctagttctttaaattgcttgattcacaagaatataaaagactgagctgagcctgatcaaaattgcaaaagcataatcaattgggcatgctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45311937 |
ctatcttagctagttctttaaattgcttgattcacaagaatataaaagactgagctgagcctgatcaaaattgcaaaagcataatcaattgggcatgctt |
45311838 |
T |
|
| Q |
118 |
gagtttggaggtgggagtgctgttcagatttttgggggactgttttctggcaattataatagcagctgctgttttttgcaactgttatggccgaacagca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45311837 |
gagtttggaggtgggagtgctgttcagatttttgggggactgttttctgtcaattataacagcagctgctgttttttgcaactgttatggccgaacagca |
45311738 |
T |
|
| Q |
218 |
gggnnnnnnnngtgttgccatgcactttggtcccctttg |
256 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
45311737 |
gggttttttttgtgttgccatgcactttggtcccctttg |
45311699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 29 - 114
Target Start/End: Original strand, 54633550 - 54633630
Alignment:
| Q |
29 |
agttctttaaattgcttgattcacaagaatataaaagactgagctgagcctgatcaaaattgcaaaagcataatcaattgggcatg |
114 |
Q |
| |
|
||||| ||||| |||||||| ||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
54633550 |
agttccttaaagtgcttgatgcacaagagtataaaagactgaactgagcctgat-----ttgcaaaagcataatcaattggacatg |
54633630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University