View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_65 (Length: 238)
Name: NF15960_low_65
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 14442843 - 14443063
Alignment:
| Q |
1 |
ttagtggtaattaattcgtttgtaaaagaatttggtagtgtcacataacaccgccttgcgaaaatttcaaaactaaatacaaagatcgcaatcacaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14442843 |
ttagtggtaattaattcgtttgtaaaagaatttggtagtgtcacataacaccgccttgcgaaaatttcaaaactaaatacaaagatcgcaatcacaattt |
14442942 |
T |
 |
| Q |
101 |
aaaacaatccttcnnnnnnnnctgagcttatctcagaaaagtttagtgagttatataattgaaataattgaaagattaccgagtaataaggagcagcagc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14442943 |
aaaacaatccttc-tttttttctgagcttatctcagaaaagtttagtgagttatataattgaaataattgaaagattaccgagtaataaggagcagcagc |
14443041 |
T |
 |
| Q |
201 |
aacaacattgataggttgatca |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14443042 |
aacaacattgataggttgatca |
14443063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 222
Target Start/End: Original strand, 14433594 - 14433646
Alignment:
| Q |
170 |
gaaagattaccgagtaataaggagcagcagcaacaacattgataggttgatca |
222 |
Q |
| |
|
||||||| |||||||||||||||| || || || |||||||||||| |||||| |
|
|
| T |
14433594 |
gaaagatcaccgagtaataaggagtaggagaaataacattgatagggtgatca |
14433646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University