View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_69 (Length: 222)
Name: NF15960_low_69
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 37641609 - 37641768
Alignment:
| Q |
1 |
tttagaaatcaagttcatttctgttggaagtagattttcaataacatttaaatttattgtttagaatact-----tcatttcaa-------tactgaaga |
88 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||| | ||| ||||||||| |
|
|
| T |
37641609 |
tttagaaatcaagttcatttcagttggaagtagattttcaataacatttaaattcattgtttagaatactgaagatcactacaaggaataatactgaaga |
37641708 |
T |
|
| Q |
89 |
tcactactttttattgccaacaaaaggtcttcaattttggaaatcacaaaaattattttc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37641709 |
tcactactttttattgccaacaaaaggtcttcaattttggaaatcacaaaaattattttc |
37641768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University