View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_72 (Length: 212)
Name: NF15960_low_72
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 20383114 - 20383308
Alignment:
| Q |
1 |
atagaaagtgcatgtttccatttttgcccttaaaattgacagtgtgtcactgaaaattgaacataatatagatttgaggtttagtacaaagatccatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20383114 |
atagaaagtgcatgtttccatttttgcccttaaaattgacagtgtgtcactgaaaattgaacataatatagatttgaggtttagtacaaagatccatgga |
20383213 |
T |
|
| Q |
101 |
ggtttcacaagcatgcaaggaagaacttgatcatgttgataagagaaatcagtcattagtgaatttctttgggtgaaacttgtgtgggtaagaat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20383214 |
ggtttcacaagcatgcaaggaagaacttaatcatgttgataagagaaatcagtcattagtgaatttcttttggtgaaacttgtgtgggtaagaat |
20383308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University