View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15960_low_74 (Length: 208)
Name: NF15960_low_74
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15960_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 56313772 - 56313594
Alignment:
| Q |
14 |
cagagagtttcccgcagcagcatattgtactaggtgcctaggttgatgctgctgctgc---atcatcatcaatccttcttcctcttctgaacggtaatta |
110 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
56313772 |
cagagagtttcccgcagctgaatattgtactaggtgcctaggttgatgctgctgctgctgcataatcatcaatccttcttcttcttctgaacggtaatta |
56313673 |
T |
 |
| Q |
111 |
gtaggaggaggagtattgctatacttggaaagcccaagagttgttgtgacatgatctgaattaccgccgctactgcttc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313672 |
gtaggaggaggagtattgctatacttggaaagcccaagagttgttgtgacatgatctgaattaccgccgctactgcttc |
56313594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University