View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15961_high_13 (Length: 227)
Name: NF15961_high_13
Description: NF15961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15961_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 6 - 131
Target Start/End: Complemental strand, 615168 - 615043
Alignment:
| Q |
6 |
atgtttgacaaatcagtgatacttgattccaatgcgtattttaggagggatcctttgccttttgggagggaaagatagagtgaatttagccaaaaattga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
615168 |
atgtttgacaaatcagtgatacttgattccaatgcgtattttaggagggatcctttgccttttgggagggaaagatagagtgaatttagccaaaaattga |
615069 |
T |
 |
| Q |
106 |
aggaaatgaaatagataataatattt |
131 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
615068 |
aggaaatgaaatagataataatattt |
615043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University