View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15961_low_6 (Length: 322)
Name: NF15961_low_6
Description: NF15961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15961_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 156 - 307
Target Start/End: Complemental strand, 2278601 - 2278450
Alignment:
| Q |
156 |
ccgctcaatcttgatcagatgatcatcgatatatcacttactataatgtagggattatcgattaattgacgaattagtgtacaaaatagccatgccaaat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2278601 |
ccgctcaatcttgatcagatgatcatcgatatatcacttattataatgtagggattatcgattaattgacgaattagtgtacaaaatagccatgccaaat |
2278502 |
T |
|
| Q |
256 |
atagtttatttgaagcatgtatggcttgaaatttgaaaggtatagtaaattt |
307 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2278501 |
atagtgtatttgaagcatgtatggcttgaaatttgaaaggtatagtaaattt |
2278450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 2278747 - 2278662
Alignment:
| Q |
10 |
gagatgaattcggattgatgcagtctacagttctcgcattcatacaatcagtatttcagtgataatttgatcaaatttgaacggtc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
2278747 |
gagatgaattcggattgatgcagtctacagttctcgcattcatacaatcagtattttagtgataatttgatcaaacttgaacggtc |
2278662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University