View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15961_low_9 (Length: 279)
Name: NF15961_low_9
Description: NF15961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15961_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 277
Target Start/End: Original strand, 31998433 - 31998702
Alignment:
| Q |
11 |
tttatgttattgattaattccc---tattaaacactatgatagattattatgcattagaaattgatcatcgatttttatgaaatgttgatgatatcgttc |
107 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31998433 |
tttatgctattgattaattcctccttattaaacactatgatagattattatgcattagaaattgatcatcgatttttatgaaatgttgatgatatcgttc |
31998532 |
T |
 |
| Q |
108 |
gatctttaacgatttcgtgaaatattcaaaatcatgaaaacaagaaaacgatatgatttaatgtccatgtaccatgtttttaatagttttagtttgaaaa |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31998533 |
gagctttaacgatttcgtgaaatattcaaaatcatgaaaacaagaaaacgatatgaattaatgtccatgtaccatgtttttaatagttttagtttgaaaa |
31998632 |
T |
 |
| Q |
208 |
ccttatctaaatggccaattgggattccaagcagacactagattgagttttaatgagtattatctaccca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31998633 |
ccttatctaaatggccaattgggattccaagcagacactagattgagttttaatgattattatctaccca |
31998702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University