View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_100 (Length: 262)
Name: NF15962_high_100
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_100 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 17594567 - 17594335
Alignment:
| Q |
17 |
tataattgtttggcagccttggcactaggttccggcagccgtggtccctcggaggttttcaaaggtttttaggggaaaggccgccggaaccggctttcga |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17594567 |
tataattgtttggcagcctcggcactaggttccggcagccacggtccctcggaggttttcaaaggtttttaggggaaaggccaccggaaccggctttcga |
17594468 |
T |
 |
| Q |
117 |
ataccaaacaacgaggaccaaatggttctcaaaaacaaagacacaaactatatatgaattattcaaatacgtaacattttttcttcttctacaaacaaag |
216 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17594467 |
ataccaaacaacgaagaccaaatggctctcaaaaacaaagacacaaactatatatgaattattcaaatacgtaacattttttcttcttttacaaacaaag |
17594368 |
T |
 |
| Q |
217 |
atattgttttcaagatttgagcacgcgaccttc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17594367 |
atattgttttcaagatttgagcacgcgaccttc |
17594335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University