View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_109 (Length: 251)
Name: NF15962_high_109
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 240
Target Start/End: Complemental strand, 46214196 - 46213961
Alignment:
| Q |
5 |
gcttttttcattctttctagtctcactgatattttatcttctgtccataaaaataataggatgtacggttaagcannnnnnnnagcttctgccttgtatg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
46214196 |
gcttttttcattctttctagtctcactgatattttatcttctgtccataaaaataataggatgtatggttaagcattttttttagcttctgccttgtatg |
46214097 |
T |
 |
| Q |
105 |
gtggtaaaactatgttcatattcttttttaaattttccaatctggaattgtactaaacatatcttccagcttgcatgggaaattagagataaatttagct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46214096 |
gtggtaaaactatgttcatattcttttttaaattttccaatctggaattgtactaaacatatcttccagcttgcatgggaaattagagataaatttagct |
46213997 |
T |
 |
| Q |
205 |
aatagttagttaagagtttgtaagttagttattctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213996 |
aatagttagttaagagtttgtaagttagttattctt |
46213961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University