View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_112 (Length: 249)
Name: NF15962_high_112
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_112 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 26 - 133
Target Start/End: Original strand, 35809508 - 35809615
Alignment:
| Q |
26 |
tattacatattatctactcacgaaattctcatattgacagtgggattcgaacttagatccttatgagatatgagttgaatccttaccaacattcatcgga |
125 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35809508 |
tattacatattatctactaacgaaattctcatattgacaatggaatttgaacttaaatccttatgagatatgagttgaatccttaccaacattcatcgga |
35809607 |
T |
 |
| Q |
126 |
ttttagta |
133 |
Q |
| |
|
|||||||| |
|
|
| T |
35809608 |
ttttagta |
35809615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 198 - 239
Target Start/End: Original strand, 35809671 - 35809712
Alignment:
| Q |
198 |
gtcaagcatttcacatttatgagtcatatcatatgcattcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35809671 |
gtcaagcatttcacatttatgagtcatatcatatacattcat |
35809712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University