View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_122 (Length: 238)
Name: NF15962_high_122
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_122 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 35808993 - 35809214
Alignment:
| Q |
16 |
ataaatgtatggttctcactattggtatattttagtgaattgttgctatttaaaggcaatcacatttcttggcctattagatcatgtgaagtcctggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808993 |
ataaatgtatggttctcactattggtatattttagtgaattgttgctatttaaaggcaatcacatttcttggcctattagatcatgtgaagtcctggttt |
35809092 |
T |
 |
| Q |
116 |
gggaattgcatgggccaatgctgtctttttactaaacnnnnnnngtttacnnnnnnnngttttggccaattggatattgacggtttatcaaggttagaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35809093 |
gggaattgcatgggccaatgctgtctttttactaaactttttttgtttac-aaaaaaagttttggccaattggatattgacggtttatcaaggttagaca |
35809191 |
T |
 |
| Q |
216 |
aagttcacacattcaatgaaccc |
238 |
Q |
| |
|
||||| ||| ||||||| ||||| |
|
|
| T |
35809192 |
aagtttacagattcaataaaccc |
35809214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University