View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15962_high_130 (Length: 233)

Name: NF15962_high_130
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15962_high_130
NF15962_high_130
[»] chr1 (1 HSPs)
chr1 (1-53)||(23378963-23379015)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 23378963 - 23379015
Alignment:
1 ttttctgttttgcacctatcttgaatcccctcacatagagttagacacgtctc 53  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
23378963 ttttctgttttgcacctatcttgaatcccctcacatagagttagacacgtctc 23379015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University