View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_139 (Length: 222)
Name: NF15962_high_139
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_139 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 21465765 - 21465576
Alignment:
| Q |
19 |
tttagcaatcttgcattgacattagcaattttgcatgaaaaactcaaccatgtctataggtatatatcaactcttggtttttcattgtttgtgtctctat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21465765 |
tttagcaatcttgcattgacattagcaattttgcatgaaaaactcaaccatgtctataggtatatatcaactcttggtttttcattgtttgtgtctctat |
21465666 |
T |
 |
| Q |
119 |
ctctagctactttcttgaactagggggactattatattgcttgtgtctctcatgtcagtctcattcatactcttgcttgaaatatttctt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
21465665 |
ctctagctactttcttgaactagggggactattatattgcttgtgtctctcatgtcagtctcattcatacttttgtttgaaatatttctt |
21465576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University