View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_140 (Length: 221)
Name: NF15962_high_140
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_140 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 10598803 - 10598619
Alignment:
| Q |
18 |
ttctccaaatcttttactctcccagtcaaatttgatattacacttatctgttcattcccagcttcaagcaactccttcatcagcttccttagcttctcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10598803 |
ttctccaaatcttttactctcccagtcaaagttgatattacacttatctgttcattcccagcttcaagcaactccttcatcagcttccttagcttctcat |
10598704 |
T |
 |
| Q |
118 |
tctcttccagtaatctcatgtcaccattcaaatctgcagatactttcgtttttataccggttggttctctgtcagcagtgtcttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10598703 |
tctcttccagtaatctcatgtcaccattcaaatctgcagatactttcgtttttgtaccggttggttctctgtcagcagtgtcttg |
10598619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University