View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_36 (Length: 404)
Name: NF15962_high_36
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 45794869 - 45795106
Alignment:
| Q |
18 |
gtctacactaccatgaatttcgcagtctctgtagaattggcgctgcgcgactgcgtataagcttccttctccgccgtcaattttgcagttgaagaatgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45794869 |
gtctacactaccatgaatttcgcagtctctgtagaattggcgctgcgcgactgcgtataagcttccttctccgccgtcaattttgcagctgaagaatgct |
45794968 |
T |
 |
| Q |
118 |
gcatgatcagaaagtacaaggagtgctgatgctcctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794969 |
gcatgatcagaaagtacaaggagtgctgatgctcctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactg |
45795068 |
T |
 |
| Q |
218 |
catttcacaagagtcaaaatcaaatgttgttatgtgtg |
255 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
45795069 |
catttcacaagagtgaaaatcaaatgttgttatatgtg |
45795106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 289 - 394
Target Start/End: Original strand, 45795098 - 45795203
Alignment:
| Q |
289 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattgataaagatgattatcttctttag |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45795098 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattaataaagatgattatcttctttag |
45795197 |
T |
 |
| Q |
389 |
tctctg |
394 |
Q |
| |
|
|||||| |
|
|
| T |
45795198 |
tctctg |
45795203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University