View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_53 (Length: 352)
Name: NF15962_high_53
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_53 |
 |  |
|
| [»] scaffold0219 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 9535 - 9654
Alignment:
| Q |
1 |
aagcacaacaagtgatgaccattgcttccagcagcatcaaactttgcactaaatttgtccacctaaatgaattaattggcaaaatcagttattttgggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9535 |
aagcacaacaagtgatgaccattgcttccagcagcatcaaactttgcactaaatttgtccacctaaatgaattaattggcaaaatcagttattttgggga |
9634 |
T |
 |
| Q |
101 |
tcgaaactaaaattggcata |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9635 |
tcgaaactaaaattggcata |
9654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 195 - 303
Target Start/End: Original strand, 10288 - 10396
Alignment:
| Q |
195 |
ttcgattaactctttgccatggaaacactatgaaggtgtttgaggacttgaaccttgttaaactccaatagaaatagggaaaatggtatccaataggcac |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10288 |
ttcgattaactctttgccatggaaacactatgaaggtgtttgaggacttgaaccttgttaaactccaatagaaatagggaaaatggtatccaataggcac |
10387 |
T |
 |
| Q |
295 |
atgcttaat |
303 |
Q |
| |
|
||||||||| |
|
|
| T |
10388 |
atgcttaat |
10396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 173
Target Start/End: Original strand, 10235 - 10288
Alignment:
| Q |
122 |
tcggcatcgtgcgtacctc--atatttgccatggaaacaacttcttcgcaaggt |
173 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10235 |
tcggcatcgtgcgtacctctcatatttgccatggaaacaacttcttcgcaaggt |
10288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University