View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_66 (Length: 332)
Name: NF15962_high_66
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_66 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 115 - 320
Target Start/End: Original strand, 43616933 - 43617138
Alignment:
| Q |
115 |
ttaaaaagaagactgctttccggctcactaatagtaatttgtatagcagattggtgcttagagcaaactaaaaatgtctaaaatcaaaaataaatgtcac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43616933 |
ttaaaaagaagactgctttccggctcactaatggtaatttgtatagcagattggtacttagagcaaactaaaaatgtctaaaatcaaaaataaatgtcac |
43617032 |
T |
 |
| Q |
215 |
ctacaccgtcgtacaatctagccgattgtgacactatcgtttatacaaagttgcatcattacactgtttaacatgcaaacaatcatttgtaaaatcatgc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
43617033 |
ctacaccgtcgtacaatctagccgattgtgacactatcgtttatacaaagttgcatcattacattgtttaacatgcaaacaatcatttgtaaaatcacgc |
43617132 |
T |
 |
| Q |
315 |
aggttc |
320 |
Q |
| |
|
|||||| |
|
|
| T |
43617133 |
aggttc |
43617138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 167 - 300
Target Start/End: Complemental strand, 275697 - 275567
Alignment:
| Q |
167 |
ggtgcttagagcaaactaaaaatgtctaaaatcaaaaataaatgtcacctacaccgtcgtacaatctagccgattgtgacactatcgtttatacaaagtt |
266 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
275697 |
ggtgcttagagcaaactaaaaatggctaaaatcaaaaataaatgtcacctacaccatcgcccaatctagccgatcatgaca-aatcgtttatacaaagtt |
275599 |
T |
 |
| Q |
267 |
gcatcattacactgtttaacatgcaaacaatcat |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |
|
|
| T |
275598 |
gcatcatt--tctgtttaacatgcaaacaatcat |
275567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 92
Target Start/End: Complemental strand, 275828 - 275758
Alignment:
| Q |
26 |
gtttttcatgaacttgcaa----atatctacaccatatgtagaaattagaataccaagaggaattggacca |
92 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
275828 |
gttttccatgaacttgcaacacaatatctacaccatccggagaaaccagaataccaagaggaattggacca |
275758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University