View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_high_76 (Length: 312)
Name: NF15962_high_76
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_high_76 |
 |  |
|
| [»] chr2 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 49 - 312
Target Start/End: Complemental strand, 15275860 - 15275596
Alignment:
| Q |
49 |
ggcatcatcttatgcaagaatgatgaacatcgcaagacataatgccattccaataaaaaggccatcattctttatcacatttgttgtcacctgagcataa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15275860 |
ggcatcatcttatgcaagaatgatgaacatcgcaagacataaagccattccaataaaaaggccatcattctttatcacatttgttgtcacctgagcataa |
15275761 |
T |
 |
| Q |
149 |
aaa-cgatcaccgaatttgtaggagaggtttaaggtacccttggatttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggca |
247 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15275760 |
aaaacgatcaccaaatttgtaggagaggtttaaggtacccttggatttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggca |
15275661 |
T |
 |
| Q |
248 |
gggttatcaagaagtcccttgagagggatacggaccttgccaatggtactgcatgggaggaattt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15275660 |
gggttatcaagaagtcccttgagagggatacggaccttgccaatggtactgcatgggaggaattt |
15275596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 161 - 312
Target Start/End: Complemental strand, 15264112 - 15263961
Alignment:
| Q |
161 |
aatttgtaggagaggtttaaggtacccttggatttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggcagggttatcaagaa |
260 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||| | | |||||||| ||||| ||||||||||| |
|
|
| T |
15264112 |
aatttgtaagagaggtttatggtacccttggatttcccagagcgttttttcctaacttgataactgaatggatgaccggcataggcagagttatcaagaa |
15264013 |
T |
 |
| Q |
261 |
gtcccttgagagggatacggaccttgccaatggtactgcatgggaggaattt |
312 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15264012 |
gtcccaagagagggatacggaccttgccaatggtactgcgtgggaggaattt |
15263961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 151 - 277
Target Start/End: Original strand, 27155665 - 27155791
Alignment:
| Q |
151 |
acgatcaccgaatttgtaggagaggtttaaggtacccttggatttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggcaggg |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||||| ||||| |||||||||||||||| |||||||||||| || ||| |||||| |
|
|
| T |
27155665 |
acgatcaccaaatttgtaggagaggtttaagctacccctggatttgtgagagggttttttcctaacctggtaactgagttggtggccagcagcagcaggg |
27155764 |
T |
 |
| Q |
251 |
ttatcaagaagtcccttgagagggata |
277 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
27155765 |
ttatcaagaagttccttgagagggata |
27155791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 152 - 277
Target Start/End: Original strand, 12835802 - 12835921
Alignment:
| Q |
152 |
cgatcaccgaatttgtaggagaggtttaaggtacccttggatttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggcagggt |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| || |||||||| ||| | |||||||||||||||||||||||||| || |||||||| |
|
|
| T |
12835802 |
cgatcaccgagtttgtaggagaggttcaaggtccctctggatttctctgagtttattttcctaacctgataactgagttggtggcc------ggcagggt |
12835895 |
T |
 |
| Q |
252 |
tatcaagaagtcccttgagagggata |
277 |
Q |
| |
|
|||||| |||| |||||||||||||| |
|
|
| T |
12835896 |
tatcaaaaagttccttgagagggata |
12835921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 189
Target Start/End: Complemental strand, 15251615 - 15251579
Alignment:
| Q |
153 |
gatcaccgaatttgtaggagaggtttaaggtaccctt |
189 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15251615 |
gatcaccaaatttgtaggagaggtttaaggtaccctt |
15251579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University