View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_102 (Length: 275)
Name: NF15962_low_102
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_102 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 41842010 - 41841746
Alignment:
| Q |
1 |
ccattcctcatttcctccttatggctccagtagcttcgtatcggcagattctatggggtggaattccatggtttatgtatgtaatgtaatcaaaaactaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41842010 |
ccattcctcatttcctccttatggctccagtagcttcgtatcggcagattctatggggtggaattccaacgtttatgtatgtaatgtaatcaaaaactaa |
41841911 |
T |
 |
| Q |
101 |
aacaagcacacggtcagaatgaaatgaagtattatgcattgctgtaactgtatatgtatcatacatatatatgcataacattttgtaggatttcagggaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
41841910 |
aacaagcacacggtcagaatgaaatgaagtattatgcattgctgtaactgtatatgtatcatacatacatatacataacattttgtaggatttcagggaa |
41841811 |
T |
 |
| Q |
201 |
agttggttttagtttatgctaactgtatatgtattgccgtctacatgcacgctttttagcctatg |
265 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41841810 |
agttgattttagtttatgctaactgtatatgtattgccgtctacatgcacactttttagcctatg |
41841746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 41841549 - 41841508
Alignment:
| Q |
197 |
ggaaagttggttttagtttatgctaactgtatatgtattgcc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41841549 |
ggaaagttgattttagtttatgctaactgtatatgtattgcc |
41841508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 265
Target Start/End: Complemental strand, 3461833 - 3461784
Alignment:
| Q |
216 |
atgctaactgtatatgtattgccgtctacatgcacgctttttagcctatg |
265 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
3461833 |
atgcaaactgtatatgtattgctgtctacatacacactttttagcctatg |
3461784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University