View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_103 (Length: 274)
Name: NF15962_low_103
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 261
Target Start/End: Original strand, 29796172 - 29796424
Alignment:
| Q |
11 |
cacagagaatgcaacattaatcatttatctacgatggagtttgagaggtctagatgtagtttagattttcagctaaggctgcaaacatgcagtgagctgc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
29796172 |
cacagagaatgcaacattaatcatttatcaacgatggagtttgagaggtctagatgtagtttagattttcagctaaggctgcaaacatgcagtaacctgc |
29796271 |
T |
 |
| Q |
111 |
acagccattgaaccaaaattcagtttggtcctattttgtgtacccttcaatcatgaacaccaccctacaaacaaaggggctgcaaccacctattcatttg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29796272 |
acagccattgaaccaaaattcagtttggtcctattttgtgtacccttcaatcatgaacaccaccctacaaagaaaggggctgcaaccacctattcatttg |
29796371 |
T |
 |
| Q |
211 |
aagtactattttta--ataatataaaaaatgcatttacagtactatatattaa |
261 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
29796372 |
aagtactatttttaatataaaaaaaaaaatgcatttacagtactatatattaa |
29796424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University