View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_112 (Length: 259)
Name: NF15962_low_112
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_112 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 44 - 193
Target Start/End: Complemental strand, 9717911 - 9717762
Alignment:
| Q |
44 |
ttaaatatttaaagggagagctttgtcatccattatagttctactcaattcaagattttactttccgtgcggaaaagataccggttcacacaaaaaatag |
143 |
Q |
| |
|
|||||||||| || |||||||||| |||||||||||||||||||| ||||||||||||||||||| | || ||||||||||| |||||||||| |||||| |
|
|
| T |
9717911 |
ttaaatatttgaaaggagagctttatcatccattatagttctactgaattcaagattttactttctgcgcagaaaagatacctgttcacacaacaaatag |
9717812 |
T |
 |
| Q |
144 |
atggagtgagcaaatgatacaactcaagattatacaaatcacatttattt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9717811 |
atggagtgagcaaatgatacaactcaagattatacaaaacacatttattt |
9717762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 3 - 49
Target Start/End: Complemental strand, 9718840 - 9718794
Alignment:
| Q |
3 |
aaggtcataggctagaattcaactctaggaatgcaacaatgttaaat |
49 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9718840 |
aaggtcatagcctagaattcaactctaggaatgcaacaatgttaaat |
9718794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University