View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_114 (Length: 256)
Name: NF15962_low_114
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_114 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 37405092 - 37404848
Alignment:
| Q |
1 |
ctcaaaatgtattgttttcctttgtttttatacccaaaagattctaaagaagcctgccttccaacttggcttgattccttggattcaaagaatattagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37405092 |
ctcaaaatgtattgttttcctttgtttttatacccaaaagattctaaagaagcatgccttacaacttggcttgattccttggattcaaagaatattagaa |
37404993 |
T |
 |
| Q |
101 |
gctttgccaaaatagaaatctgtccgggcgtggaacttttgtgacataagccggcaatgtgtcgtgttcaaggtcagatgtttctatgaaaggtagat-t |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37404992 |
gctttaccaaaatagaaatctgtccgggcgtggaacttttgtgacataagccggcaatgtgtcgtgttcaaggtcggatgtttctatgaaaggtagatga |
37404893 |
T |
 |
| Q |
200 |
ttcccatctctttctctcatggaatcctcctctttttgtaatatt |
244 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37404892 |
atcccatctctttctctcaaggaatcctcctctttttgtaatatt |
37404848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University