View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_120 (Length: 250)
Name: NF15962_low_120
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_120 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 23378891 - 23378690
Alignment:
| Q |
18 |
tgtgtcctattctccactaaaacatgttttctacatcaatgtcattttcaagaatcttaatagcatagcttaatttgtcattcgcaatatgcaatataca |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23378891 |
tgtgtcctattctccactaaaatatgttttctaaatcaatgtcattttcaagaatcttaatagcatagcttaatttgtcattcgcactatgcaatataca |
23378792 |
T |
 |
| Q |
118 |
ccgccttttgaatgtgatcgcacattaagtnnnnnnnctagttgaaaaattaatatgcaatagatattccttattgtttataatttacttaaatataaca |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23378791 |
ccgccttttgagtgtgatcgcacattaagtaaaaaaactggttgaaaaattaatatgcaatagatattccttattgtttataatttacttaaatataaca |
23378692 |
T |
 |
| Q |
218 |
ac |
219 |
Q |
| |
|
|| |
|
|
| T |
23378691 |
ac |
23378690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 25933704 - 25933660
Alignment:
| Q |
33 |
actaaaacatgttttctacatcaatgtcattttcaagaatcttaa |
77 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||| ||||| |
|
|
| T |
25933704 |
actaaaacatgtcttctacatcaatgtcattatcaagaagcttaa |
25933660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University