View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_123 (Length: 249)
Name: NF15962_low_123
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_123 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 27700032 - 27699813
Alignment:
| Q |
13 |
aagaaaatagttaaggagcttaaggacttgcagagagatccaccaacctcatgcagtgcaggtaaagagtttgaatgaaacttgaactggtttatttaac |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27700032 |
aagagaatagttaaggagcttaaggacttgcagagagatccaccaacctcatgcagtgcaggtaaagagtttgaatgaaacttgaactggtttatttaac |
27699933 |
T |
|
| Q |
113 |
aataactgtagtgtgatgtgtttgttatgacgagcttcaggtccagtcggcgaggacatgtttcattggcaagcaactatcattggtccaaatgatagtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27699932 |
aataactgtagtgtgatgtgtttgttatgacgagtttcaggtccagtcggcgaggacatgtttcattggcaagcaactatcattggtccaaatgatagtc |
27699833 |
T |
|
| Q |
213 |
cctatgctggtggtgttttc |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27699832 |
cctatgctggtggtgttttc |
27699813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 164 - 228
Target Start/End: Complemental strand, 28200729 - 28200665
Alignment:
| Q |
164 |
gaggacatgtttcattggcaagcaactatcattggtccaaatgatagtccctatgctggtggtgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| || || |||||| ||||||||||||||||| |
|
|
| T |
28200729 |
gaggacatgtttcattggcaagcaacaatcatgggacctgctgatagcccctatgctggtggtgt |
28200665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University