View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_131 (Length: 240)
Name: NF15962_low_131
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_131 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 35844748 - 35844956
Alignment:
| Q |
20 |
gaagggagtgcatttattgggacatttctaccagaattggggtggggaagaatatattttaagccattaaatagttacaggaatttga-ttaannnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35844748 |
gaagggagtgcatttattgggacatttctaccagaattggggtggggaagaatatattttaagccattaaatagttacaggaatttgatttatttttttt |
35844847 |
T |
|
| Q |
119 |
atcaaactaagagagcgcagagatcgtccacatttgatc-aaaaactgccgttgaacaccatatcttaaactaaaacattagatacatgactcttcttat |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| | |||| ||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
35844848 |
atcaaactaagagagagcagagatcgtccacatttgatcaaaaaactacagttggacaccatatcttaaactaagacattagatatatgactctttttat |
35844947 |
T |
|
| Q |
218 |
ttatatatt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
35844948 |
ttatatatt |
35844956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University