View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_136 (Length: 237)
Name: NF15962_low_136
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_136 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 46214187 - 46214407
Alignment:
| Q |
1 |
tgaaaaaagcataaccatctattatatttatggacataagctaaaatgtcaatgaagcttgaaataatgaaaattgtttaaccatccattatatttatga |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46214187 |
tgaaaaaagcttaaccatctattatatttatggacataagctaaaatgtcagtgaagcttgaaataatgaaaattgtttaaccatccattatatttatgt |
46214286 |
T |
 |
| Q |
101 |
ataggtgcaagaattgcagcatacaaagtgtgttggactggtggatgtttcagctcagatattctatcagctgttgatacagctgtagctgatggagtcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46214287 |
ataggtgcaagaattgcagcatacaaagtgtgttggactggtggatgtttcagctcagatattctatcagctgttgatacagctgtagctgatggagtcg |
46214386 |
T |
 |
| Q |
201 |
atgttctatccatctctttag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46214387 |
atgttctatccatctctttag |
46214407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 46214138 - 46214218
Alignment:
| Q |
19 |
ctattatatttatggacataagctaaaatgtcaatgaagcttgaaataatgaaaattgtttaaccatccattatatttatg |
99 |
Q |
| |
|
||||||| |||||||||| ||| |||||| ||| ||| || |||| |||||||| | ||||||||| |||||||||||| |
|
|
| T |
46214138 |
ctattatttttatggacagaagataaaatatcagtgagactagaaagaatgaaaaaagcttaaccatctattatatttatg |
46214218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University