View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_138 (Length: 236)
Name: NF15962_low_138
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_138 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 29 - 224
Target Start/End: Original strand, 55337251 - 55337447
Alignment:
| Q |
29 |
tatactattgtgacagggaggatgagtgcaacttgtaatgttatagttttattcaattttttaagacaa-gagttatgggaggtattaaacaaataggtt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
55337251 |
tatactattgtgacagggaggatgagtgcaacttgtaatgttatagttttattcaattttttagtacaaagagttatgggaggtattaaacaaataggtt |
55337350 |
T |
|
| Q |
128 |
cttagatacctatggaccaaatgtaggaatatttgtatacacacaataaaataacatgtttttagtattaaaaaatgaagctaatgagttcatgtca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55337351 |
cttagatacctatggaccaaatgtaggaatatttgtatacacacaataaaataacatgtttttagtattaaaaaatgaagctaatgagttcatgtca |
55337447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University