View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_141 (Length: 235)
Name: NF15962_low_141
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_141 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 45037759 - 45037562
Alignment:
| Q |
20 |
gaaggtgctgtgacatattgaacacgacctacctcagacaatgcttgtacgaatggctcaatttcaacaccattcgtttgtacttcaccacttccactca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45037759 |
gaaggtgctgtgacatattgaacacgacctacctcagacaatgcttgtacgaatggctcaatttcaaaaccattcgtttgtacttcaccacttccactca |
45037660 |
T |
|
| Q |
120 |
aattcttgttgtaatcaagagatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037659 |
aattcttgttgtaatcaagagatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccct |
45037562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University