View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_144 (Length: 233)
Name: NF15962_low_144
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_144 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 37403865 - 37404078
Alignment:
| Q |
8 |
gactgaaaagaaaaagacagatcaaataaataaaaatagatgatataagcaatgcaagcattgaatatacaaataactaacatgtcattgtcatgtgggg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37403865 |
gactgaaaagaaaaagacagatcaaataaatacaaatagatgatataagcaatgcaggcattgaatatacaaataactaacatgtcattgtcatgtgggg |
37403964 |
T |
 |
| Q |
108 |
ctgggttgattccttctgttacataattttaaggtgactagttggctagggtgaaacacaatgaatgatacctctcatgtgataaggtcatcatccattg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37403965 |
ctgggttgattccttctgttacataattttaaggtgactagttggctagggtgaaacacaatgaatgatacctctcatgtgataagatcatcatccattg |
37404064 |
T |
 |
| Q |
208 |
aaaatgagagagaa |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37404065 |
aaaatgagagagaa |
37404078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University