View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_150 (Length: 224)
Name: NF15962_low_150
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_150 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 55 - 218
Target Start/End: Original strand, 10587676 - 10587847
Alignment:
| Q |
55 |
taactttacagtatattaaaaacaaatcaagatagtatacatgcaagaat---------atttaaaccaagaaaccaaaatagaagnnnnnnnntatgta |
145 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
10587676 |
taactttacagtatattaaaaaaaaatcaagatagtatacatgcaagaatcaaacacatatttaaaccaagaaaccaaaatagaagaaaaaaa-tatgta |
10587774 |
T |
 |
| Q |
146 |
ttacctgtgactccaaaggaagtttcactgctgaaattaagccattttgagaacaatccatgcacaggttctg |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10587775 |
ttacctgtgattccaaaggaagtttcactgctgaaattaagccattttgagaacaatccatgcacagattctg |
10587847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 1122586 - 1122631
Alignment:
| Q |
1 |
ctcgatcaaactacgttcttttgacactatgtttcgtctttctcaa |
46 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
1122586 |
ctcgatcaaactacgttcttttgaaactatgtttcatctttctcaa |
1122631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University