View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_159 (Length: 205)
Name: NF15962_low_159
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_159 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 24 - 192
Target Start/End: Original strand, 41783879 - 41784047
Alignment:
| Q |
24 |
aggtttattgaataactgatgtatctgacctgcattattaacagttatgtggtttctttcttccttttcgtgtagtcatgggatttaattagttcaccag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41783879 |
aggtttattgaataactgatgtatctgacctatattattaaccgttatgtggtttctttcttccttttcgtgtagtcatgggatttaattagttcaccag |
41783978 |
T |
 |
| Q |
124 |
attcaactctgtggtcaccgatgagttgtaaccaagggagctcagaagggtcatctctggattcatctc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41783979 |
attcaactctgtggtcaccgatgagttgtaaccaagggagctcagaagggtcatctctggattcatctc |
41784047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University