View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_161 (Length: 201)
Name: NF15962_low_161
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_161 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 13792262 - 13792434
Alignment:
| Q |
17 |
actatcaaacattgatttgcaaacacataacacctgacatgcacatgtagaaaatgaaactatgtgtaggtgctgtacgaattgaatgaaaaaggaaagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13792262 |
actatcaaacattgatttgcaaacacataacacctgacgtggacatgtagaaaatgaaactatgtgtaggtgctgtacgaattgaatgaaaaaggaaagt |
13792361 |
T |
|
| Q |
117 |
aaattcataaaattcacataccacagataaacgttcaattttatctttatacatctccccagcattcatctca |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13792362 |
aaattcataaaattcacataccacagataaacgttcaattttatctttatacatctccccagcattcttctca |
13792434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University