View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_37 (Length: 421)
Name: NF15962_low_37
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 225 - 406
Target Start/End: Original strand, 12469866 - 12470046
Alignment:
| Q |
225 |
gtactcatgtaccagatatagaaactaattacttgttacctagcctgcatatgtagcaacaggtttacaaaattattgtcattctaatttct-aactcca |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
12469866 |
gtactcatgtaccagatatagaaactaattacttgttacctagcctgcatatgtagcaacaagtttacaaaatt--tgtcattctaatttcttaactcca |
12469963 |
T |
 |
| Q |
324 |
aggcaagtaaatcctctctgccttattaaaaaatccagctcaaaatttctttcacaatggtgagtttcacccacaaagaacat |
406 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12469964 |
aggcaagtaaatcctctctgccttaataaaaaatctagttcaaaatttctttcacaatggcgagtttcacccacaaagaacat |
12470046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 12469818 - 12469862
Alignment:
| Q |
18 |
aaggaatttcattgaaagttttatgatggaaattattactgatat |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12469818 |
aaggaatttcattgaaagttttatgatggaaattattactgatat |
12469862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University