View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_38 (Length: 413)
Name: NF15962_low_38
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 244 - 400
Target Start/End: Original strand, 37322957 - 37323113
Alignment:
| Q |
244 |
tctctctctttttctcaagaaaatgcaaagcaatggggctttccaaattgaaagcatatcacacgctctctccctgcagatttgcttcctatattaatga |
343 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37322957 |
tctctctctctttctcaagaaaatgcaaagcaatggggctttccaaattgaaagcatatcacacgctctctccctgcagatttgcttcccatattaatga |
37323056 |
T |
|
| Q |
344 |
ctctgtctcacgcaagctggctctgctacgcctaacaccatttactactatcatgtt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37323057 |
ctctgtctcacgcaagctggctctgctacgcctaacaccatttactactatcatgtt |
37323113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 37322803 - 37322923
Alignment:
| Q |
124 |
aatgaattttgtaagtgaaaaatttagagtagatgaatggtagtagtgtactactacaagttctccctagctatcgggccacacatattgattactccta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37322803 |
aatgaattttgtaagtgaaaaatttagagtagatgaatg---gtagtgtactactacaagttctccctagctatcgggccacacat-----ttactccta |
37322894 |
T |
|
| Q |
224 |
taagattcacattcattctttctctctct |
252 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
37322895 |
taagattcacattcattctctctctctct |
37322923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University