View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15962_low_67 (Length: 337)
Name: NF15962_low_67
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15962_low_67 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 17 - 326
Target Start/End: Complemental strand, 425190 - 424879
Alignment:
| Q |
17 |
cttagaccctctaccctccgctgtgatgaatggtgtcccttgcttcatctagaagcaatccatcatcaattttctctcgccacaaaattggtgatcttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
425190 |
cttagaccctctaccctccgctgtgatgaatggtgtcccttgcttcatctagaagcaatccatcatcaattttctctcgccacaaaattggtgatcttat |
425091 |
T |
|
| Q |
117 |
acacacccaaagatggtgaaattcagttttattcgatgaatttaacttattcaagaatcttgtccccttcattgttgcagactaagttgaattttacttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
425090 |
acacacccaaagatggtgaaattcagttttattcgatgaatttaacttattcaagaatcttgtccccttcattgttgcagactaagttgaattttacttc |
424991 |
T |
|
| Q |
217 |
tagcaactatctttaaacggggaattttagnnnnnnnctaatcaattttacttatccttgttagattatatgaagaa--gtgtgtgtaccatgttgcggc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
424990 |
tagcaactatctttaaacggggaattttagtttttttctaatcaattttacttatccttgttagattatatgaagaaatgtgtgtgcaccatgttgcggc |
424891 |
T |
|
| Q |
315 |
ctaaaatttgag |
326 |
Q |
| |
|
|||||||||||| |
|
|
| T |
424890 |
ctaaaatttgag |
424879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University